Tiburonia granrojo n. sp., a mesopelagic scyphomedusa from 
the Pacific Ocean representing the type of a new subfamily
(Class Scyphozoa, Order Semaeostomeae, Family Ulmaridae,
Subfamily Tiburoniinae subfam nov.)

Large subunit ribosomal RNA sequence (GenBank AY149900) and methodology

TTAATAATCGGAGGAAAAGCAACTCACCAAGGATTCCGCCGAGTAACGGC
GAGTGAAGCGGGAATGGCTCAAGCTTGAAATCTCTGTTGCATGCAACAGC
GAATTGTAGTCTCGAGAAGCGTCTTCCTGGCGGATCTTCCCTGCCTAAGT
TGCTTGGAACAGGACATCGAAGAGGGTGACAATCCCGTTTGTGGCAGGGA
AGACCGTCTACGATACGCTTTCCATGAGTCGGGTTGCTTGGGAATGCAGC
CCAAAACTGGTGGTAAACTCCATCTAAAGCTAAATATTGGCACGAGACCG
ATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGA
GTTAAAAAGTGCGTGAAACCGTTAGAGGGGAAGCGGATGCAGTTAGCAAT
GCTTCTGTGAGATTCAGGCGGTCGCTCGGCCAGACGTGTAGATGGTGGAT
CTGAATGGACCTTCGCTGCACGACCGGGTCTTGTGCCCGTCGCACTTCTC
GCAGGAGTGCGTCAACAGCTGCTGGGCCTGATTGACATGGCTTCGTGGAA
GGTAGGCAGATGGTTTACCATCGGTTGTTACAGTCGCGGGTGCCTAGCTC
GGGCTTGGCAGAGGTGAGCGGTGCATGCTCTCTCTTCGGAGAGGGCTGGC
GTCCTGCTTTGTTCGCGTAGCAGGCCTAGGCGCACTGCATGCAGTACGTC
TTAGCGGGTGAAAGAAAGGGCGAGCAGTAAACGCACACGATGTGCCATGG
TTGTTGGCGGCAATATGGCTTTATCCGACCCGTCTTGAAACACGGACCAA
GGAGTCTAACATGTGCGCAAGTCTTGGGGTGACCGAAACCCAGAGGCGCA
ATGAAAGTGAAGGCTGCCTGGCAGCTGAGGTGAGATCTTTGCTCCACGTG
AGTGAGGCGCATCATCGACCGACCTATTCTAAGTTCTCTTAGGAAGGTTT
GAGTAAGAGCGTACATGCTGGGACCCGAAAGATGGTGAACTATGCCTGAG
TAGGGTGAAGCYAGAGGAAACTCTGGTGGAAGCTCGTAGCGATT

Methodology

Tissue samples for molecular analysis were collected with the ROV Tiburon and either frozen at -80° C or pressed onto FTA® paper (Whatman Bioscience). Genomic DNA was extracted from frozen tissue using a modified CTAB-DTAB protocol (Gustinich et al. 1991). Approximately 300 µl of tissue was placed into a 2-ml eppendorf tube and 600 µl lysis buffer (8% DTAB, 1.5M NaCl, 100mM Tris-Cl, pH 8.6, 50mM EDTA) was added and the tube was then incubated at 68°C for 5 min. Chloroform (900 µl) was added to deproteinize the tissue, the tube was inverted two to three times and then spun at XXXXX g for 2 min. The supernatant was removed (discarding the lower section and being careful to avoid the tissue detritus at the interface). The DNA was precipitated by adding 900 µl of water and 100 µl of CTAB (5% CTAB, 0.4M NaCl) to the supernatant, mixed by inversion and spun at 10,000 rpm for 2 min. The pellet was resuspended in 300 µl 1.2 M NaCl and 750 µl EtOH added. The solution was mixed and spun at XXXXX g for 10 min to precipitate the DNA, rinsed with 300 µl 70% EtOH and dried. The DNA was resuspended in 50 µl of water and 1 µl was used for a 30-µl PCR reaction. DNA samples from the FTA® paper were extracted by placing a small disc of the paper into 200 µl of a 1% SDS, 2mM EDTA pH 8.0 solution for 10 min. This was washed for five min, three times with 200 µl of TE buffer. The buffer was removed and the paper was rinsed with 200 µl of 70% ethanol or isopropanol and dried at 55°C for five min. The paper was placed directly into a PCR tube with the PCR reagents (1.0 µl TAQ, 4 µl of each primer, 6 µl dNTP, 10 µl 10X buffer, and 75 µl H₂0) and amplified. The 28S rRNA gene was amplified (2 min denaturation at 94^ºC followed by 30 cycles of 0:30 min at 94^ºC, 30 s at 55^ºC, and 1:10 min at 72^ºC, with a seven min extension step at 72^ºC) using slightly modified universal primers (LSUD1F ACCCGCTGAATTTAAGCATA; D3Ca ACGAACGATTTGCACGTCAG or LSUD4Ra AACCAGCTACTAGRYGGTTCGAT) developed by Scholin and Anderson (1994). The PCR product was then either sequenced directly or cloned into TOPO TA vector and then sequenced. In both cases, the results from multiple PCR reactions or plasmid DNAs from two to five individual clones were sequenced individually and as a pool with the SequiTherm EXCEL II Long-Read DNA sequencing kit (Epicentre Technologies) and analyzed on a LI-COR 4200 IR2 instrument. Some of the clones were also sequenced with the BigDye Terminator v.2 or v.3 sequencing kit and analyzed on an ABI 3100 instrument.

Back to Midwater Page